Research Studies
Study Tracker
Fluoride regulates the expression of extracellular matrix HSPG and related signaling pathways FGFR3 and Ihh/PTHrP feedback loop during endochondral ossification.Full Text:
Highlights
- Fluoride promotes the expression of HSPG in growth plate of rats during endochondral ossification.
- Fluoride activates FGFR3 signaling pathway during endochondral ossification.
- Fluoride inhibits Ihh/PTHrP feedback loop during endochondral ossification.
Abstract
- Fluoride promotes the expression of HSPG in growth plate of rats during endochondral ossification.
- Fluoride activates FGFR3 signaling pathway during endochondral ossification.
- Fluoride inhibits Ihh/PTHrP feedback loop during endochondral ossification.
Skeletal fluorosis causes growth plate impairment and growth retardation during bone development. Longitudinal bone development is accomplished by endochondral ossification in growth plate. However, the mechanism of fluoride impairs growth plate is unclear. To explore the effect of fluoride on various glycosaminoglycans (GAGs) and related signaling pathways in growth plate during endochondral ossification, SD rats and ATDC5 cells were treated with fluoride and carried out a series of experiments. We found that the expression of heparan sulfate (HS), a kind of GAGs in extracellular matrix, was significantly increased in the growth plate of fluoride-treated rats compared with control rats. Furthermore, the expression of HS synthetic enzyme exostosin 1 (EXT1) and glypican 6 (GPC6), a core protein of HS proteoglycan (HSPG), were significantly increased in fluoride-treated ATDC5 cells compared with control cells (P < 0.05). The expression of related molecules including fibroblast growth factor receptor-3 (FGFR3), signal transducer and activator of transcription 1 (STAT1) and parathyroid hormone-related protein (PTHrP) were significantly increased in the fluoride-treated groups compared with control groups (P < 0.05), and there was significantly decreased in the expression of Indian hedgehog (Ihh) in fluoride-treated groups compared with control groups (P < 0.05). Our data suggested that fluoride increased the content of HSPG in extracellular matrix by promoting the expression of EXT1 and GPC6. Fluoride also activated FGFR3 signaling pathway, inhibited Ihh/PTHrP feedback loop and inhibited endochondral ossification. Nevertheless, the regulation of fluoride on HSPG and related pathways FGFR3 and Ihh/PTHrP feedback loop during endochondral ossification needs to be further studied.
1. Introduction
Fluoride, an essential trace element which is widely distributed in the crust, is closely related to health (Sharma et al., 2017). An appropriate amount of fluoride maintains the hardness of the bone and tooth, further promotes skeletal development and tooth health. Chronic ingestion of excessive fluoride causes systemic diseases which mainly include skeletal fluorosis and dental fluorosis (Kurdi, 2016). Skeletal fluorosis manifests osteosclerosis, osteomalacia, osteoporosis and ectopic ossification (Kebede et al., 2016). Epidemiological investigations showed that reducing the content of fluoride in drink water significantly decreased the delayed rate of bone-age and relieved the inhibition of bone development in fluorosis areas (Zhai et al., 2000). Endochondral ossification is the main way of long bone formation and it mainly occurs in the growth plate. Guo X and co-workers have found that fluorosis impairs the chondrocyte differentiation and normal mineralization of growth plate (Guo et al., 2002). Previous studies have reported that rats treated with high concentration of fluoride shows an abnormal morphology of chondrocytes and a decrease in matrix volume between chondrocytes column in growth plate compared with control rats (Yesildag et al., 2004). These changes suggest that fluoride has adverse effect on development of growth plate. However, the precise mechanism of impairment remains to be determined.
Longitudinal bone growth starts with mesenchymal cells condensation, then cells differentiate into chondrocytes and form cartilage elements. Simultaneously, cells surrounding cartilage elements form perichondrium. Cells in the center of cartilage elements go through a series of differentiation processes that are sequentially showed as proliferating, pre-hypertrophic, hypertrophic, and terminal hypertrophic chondrocytes until achieve maturation (Magne et al., 2005). The cartilage is subsequently invaded by blood vessels, eventually replaced by bone and bone marrow. At this time, primary ossification centers (POCs) are formed. Secondary ossification centers (SOCs) are formed at the each end of the cartilage elements. The histological structure between POC and SOC is called growth plate which is mainly formed by columns of chondrocytes and surrounding extracellular matrix (ECM) (Hochberg, 2002). ECM participates in cell migration, proliferation, differentiation and other activities by transferring signal molecules and providing a living environment. Proteoglycan (PG), one component of the ECM, is formed by a core protein and many kinds of glycosaminoglycan (GAG) chains. The GAGs which mainly include hyaluronic acid (HA), chondroitin sulfate (CS), heparan sulfate (HS), keratan sulfate (KS) and dermatan sulfate (DS) regulate the distribution and affinity of signaling molecules. The interaction between chondrocytes and ECM plays an important role in cartilage development during endochondral ossification.
Endochondral ossification involves many signaling molecules such as fibroblast growth factors (FGFs), Indian hedgehog (Ihh), parathyroid hormone-related protein (PTHrP), Wnt proteins and so on (Li and Dong, 2016). As one of the vital signaling pathways during endochondral ossification, FGFs signaling combines with FGF receptor-3 (FGFR3), activates signal transducer and activator of transcription 1 (STAT1) which is one of FGFs signaling downstream molecules, and inhibits proliferation and differentiation of growth plate chondrocytes (Minina et al., 2002). Ihh/PTHrP feedback loop lies downstream of FGFs signaling, keeps chondrocytes in the state of proliferation and inhibits the onset of hypertrophic differentiation during endochondral ossification (Vortkamp et al., 1996). Signaling pathways including FGFR3 and Ihh/PTHrP feedback loop modulate chondrocyte proliferation and differentiation, further regulate endochondral ossification. Nevertheless, changes of these signaling pathways in fluorosis growth plate are still unclear.
Chronic excessive ingestion of fluoride delays the process of bone formation. We hypothesized that fluoride changed the components of extracellular matrix and regulated related signaling pathways such as FGFR3 and Ihh/PTHrP in growth plate. In order to explore the effect of fluoride on the endochondral ossification, we established a rat model of fluorosis in vivo and cultured fluoride-treated ATDC5 cells which imitate the proliferation and differentiation process of growth plate chondrocyte in vitro. The changes of growth plate morphology, extracellular matrix content and expression level of related molecules were analyzed by histology, real-time PCR, immunohistochemistry and western blot.
2. Materials and methods
2.1. Animals
Twenty male weanling SD rats (postnatal day 21, weight from 50 g to 70 g) were obtained from Experimental Animal Center of China Medical University and were divided into two groups by matching weight. After two days of acclimatization, control group rats were treated with distilled water and fluoride-treated rats were treated with distilled water containing 100 mg/L F– for twelve weeks. This concentration of fluoride is based on previously reported animal studies on the growth plate of fluorosis rats (Guo et al., 2002; Yesildag et al., 2004). During fluoride treatment, all of them were housed in a room at constant temperature and received a standard rat chow ad libitum. After that, rats were anesthetized and left tibias were collected. All animal experiments were approved by the Ethics Committee of China Medical University (Shenyang, China).
2.2. Histology
Proximal tibias were fixed in 4% paraformaldehyde for two days, decalcified in 10% EDTA for one month and embedded in paraffin. After sectioned at a thickness of 5??m, tibia sections were deparaffinized in xylene, rehydrated and stained with hematoxylin and eosin (H&E). The morphological changes of tibia growth plate were observed by microscope (Nikon Ni-U; Nikon, Tokyo, Japan) at 20× and 40× magnification and photos were captured in representative regions.
2.3. Extracellular matrix staining analysis
According to “critical electrolyte concentration” (CEC) technique, graded concentrations of MgCl2 were used to specifically identify different kinds of GAGs in extracellular matrix (Scott and Dorling, 1965). Staining solution which specifically identified HA was prepared with 0.05 M MgCl2, 0.05% Alcian blue and 0.025 M acetate buffer at pH 5.8. Similarly, Alcian blue dye solutions dissolved 0.4 M, 0.7 M or 1 M MgCl2 were used to identify CS, HS and KS, respectively. Tibial growth plate sections were deparaffinized, rehydrated and immersed in solution overnight. Then they were counterstained with neutral red. After dehydrated in ethanol and cleared in xylene, sections were examined with microscope at 40× magnification and photos were captured in representative regions.
2.4. Immunohistochemistry
Paraffin sections were deparaffinized with xylene and rehydrated successively in ethanol. After treating with 0.01 M citrate buffer for antigen retrieval, endogenous peroxidase was inactivated with 3% H2O2 for 10 min. Tissue were then blocked with 5% BSA for half an hour at 37 °C and incubated at 4 °C with primary antibody overnight. Primary antibodies were used as follows: FGFR3 (1:100; BOSTER, Wuhan, China), STAT1 (1:100; BOSTER, Wuhan, China), Ihh (1:100; Abcam, Cambridge, UK) and PTHrP (1:100; BOSTER, Wuhan, China). Primary antibody was identified by goat anti-rabbit secondary antibody at 37 °C for 30 min. Sections were rinsed again in PBS and incubated in 100 l SABC (BOSTER, Wuhan, China) for 30 min. After that, they were colored with DAB (BOSTER, Wuhan, China) and counterstained with hematoxylin for 5 min. Images were observed by microscope and photos were captured in representative regions.
2.5. Cell culture
Chondrogenic cell line ATDC5 cells obtained from FuHeng Cell Center (Shanghai, China) were maintained in Dulbecco’s Modified Eagle Medium (DMEM) (Gibco, CA, USA) medium containing 10% fetal bovine serum, 100 U/ml penicillin and 100 g/ml streptomycin (Gibco, CA, USA). They were incubated in medium supplemented with ITS (10 g/ml insulin, 5.5 g/ml transferrin, 6.7 ng/ml sodium selenite) (Gibco, CA, USA) which was used to induce ATDC5 cells differentiation and were treated with or without 41.99 mg/L NaF for 7 days throughout the experiment. Cells were cultured at 37 °C with a humidified atmosphere of 5% CO2 and the medium was changed three times a week.
2.6. Real-time PCR
Total RNA was extracted from ATDC5 cells with Trizol Reagent (Takara, Dalian, China) and complementary DNA (cDNA) was synthesized by RNA using reverse transcriptase kit (Takara, Dalian, China) according to the manufacturer’s instructions. Real-time PCR was carried out with 2 l cDNA, 10 l Taq polymerase, 0.8 l each of forward and reverse primers, 0.1 l ROX reference dye and distilled water in a total reaction volume of 20??l. The cycling process was as follows: 94 °C for 7 min, denaturation (94 °C, 30s), 35 cycles of annealing (60 °C, 30 s) and extension (72 °C, 7 min). The reactions were performed using ABI 7500 Real-time PCR System and the expression levels of FGFR3 and PTHrP mRNA were expressed as RQ = 2???Ct. Specific forward and reverse primer sequences for FGFR3, PTHrP and housekeeping gene GAPDH were showed in Table 1.
Table 1. PCR primer sequence.
| Gene | Forward primer(5 -3 ) | Reverse primer(5 -3 ) |
|---|---|---|
| FGFR3 | TATCCAGGACCCGGCTGAC | GGCAGTACGGTCCTTG |
| PTHrP | GGAGTGTCCTGGTATTCCTGCT | TTGGATGGACTTGCCCTTG |
| GAPDH | AAGAAGGTGGTGAAGCAGGCATC | CGGCATCGAAGGTGGAAGAGTG |
2.7. Western blot analysis
Cells were lysed with 500 l/well ice-cold lysis buffer from Minute™ Total Protein Extraction Kit (Invent biotechnologies, Beijing, China) in six-well plates. Then the mixture was centrifuged and the protein was extracted. After measured concentration using the BCA Protein Assay Kit (Dingguo, Beijing, China), 20 ?g of total protein was loaded on each lane. Then the protein were separated by 10% SDS-PAGE gel (80 V, 20 min; 120 V, 80 min) and blotted onto PVDF membrane (Millipore, Bedford, USA) at 100 V for one hour. The membrane was blocked by 5% nonfat dry milk in PBS and incubated with rabbit polyclonal antibodies overnight at 4 C. All antibodies were used as follows: FGFR3 (1:500; ABclonal, Wuhan, China), STAT1 (1:500; BOSTER, Wuhan, China), EXT1 (1:500; Sangon Biotech, Shanghai, China), GPC6 (1:500; ABclonal, Wuhan, China) and GAPDH (1:5000; Cell Signaling Technology, USA). After incubated with secondary antibodies for one hour, the intensity was detected using the Odyssey Infrared Imaging (LI-COR, USA) and semi-quantitative analysis of protein bands was performed using Image Studio, version 5.2. The expression of GAPDH or ?-actin (1:500; BOSTER, Wuhan, China) was used as internal control.
2.8. Statistical analysis
Data were expressed as mean ± SD. A Shapiro-Wilk normality test was performed to evaluate Gaussian distribution of the data and the data had a normal distribution. Differences between groups were analyzed with two-sided Student’s t-test using GraphPad Prism 7 software and P?<?0.05 was considered significant. All experiments were repeated three to four times, and the representative data were used in results.
3. Results
3.1. Fluoride changed the normal morphology of growth plate in rats
Representative proximal tibia growth plates from control and fluoride-treated rats were shown in Fig. 1. Chondrocytes were arranged in columns and ECM was distributed uniformly around columns of chondrocyte in growth plate of control group. In contrast, the columns of chondrocytes were arranged in disorder and the size of hypertrophic cells and the thickness of growth plate were both significantly increased in the growth plate of fluoride-treated rats compared with control rats.
Fig. 1. Fluoride induced morphological changes in growth plate. Hematoxylin and eosin (H&E) staining of rat tibia growth plates from control group (left panels) and fluorosis group (right panels). RZ, reserve zone; PZ, proliferative zone; HZ, hypertrophic zone. Upper panels magnification 20× and lower panels magnification 40 × . Scale bars: 100 ?m and 50 ?m, respectively.
3.2. Fluoride promoted the expression of HSPG in ECM
In order to identify different acidic glycosaminglycans in the growth plate of rats, the cartilage matrix was stained with Alcian blue containing different concentrations of MgCl2. Alcian blue dye containing 0.05 M MgCl2 specifically recognized HA in the growth plate. The intensity and domain of blue staining between two groups were not significantly different (Fig. 2, HA). Alcian blue dye containing 0.4 M MgCl2 mainly recognized CS in the growth plate. There was not significantly different in CS between the growth plates of fluoride-treated rats and control rats (Fig. 2, CS). Alcian blue dye mixed with 0.7 M MgCl2 specifically characterized the distribution of HS in the growth plate. The blue-stained matrix was mainly HS which distributed around proliferating and pre-hypertrophic chondrocytes in control and fluoride-treated growth plate. The intensity of blue-stained was significantly increased in growth plate of fluoride-treated rats compared with that of control rats which was less blue staining and mainly stained in red due to neutral red counterstaining (Fig. 2, HS). There was no expression of KS which was identified by 1 M MgCl2 in growth plate and ECM was only showed in red as a result of neutral red counterstaining (Fig. 2, KS). These findings indicated that fluoride increased the expression of HS in growth plate of rats.
Fig. 2. Fluoride affected extracellular matrix of growth plate. Tibia growth plate sections from control rats (left panels) and fluorosis rats (right panels) were stained with Alcian blue dye containing graded concentrations of MgCl2 and counterstained with neutral red. Approximately 0.05 M, 0.4 M, 0.7 M and 1 M MgCl2 were specifically identified HA, CS, HS and KS, respectively. Arrowheads indicated that HS surrounded chondrocytes in the growth plate of control rats and fluoride-treated rats. All panels, magnification 40 × . Scale bars: 200 ?m.
To further study the reason of increased expression of HSPG after fluoride-treatment, HS synthetic enzyme exostosin 1 (EXT1) and HSPG core protein glypican 6 (GPC6) were measured by western blot in ATDC5 cells. The contents of EXT1 and GPC6 were significantly increased in cells after fluoride-treatment compared with control cells (P < 0.05) (Fig. 4A, quantified in 4D and 4E). These results clearly demonstrated that fluoride increased the contents of EXT1 and GPC6, thus promoted the expression of HSPG in ECM.
3.3. Fluoride stimulated FGFR3 and STAT1 expression during endochondral ossification
To explore whether fluoride affected FGFR3 expression, immunohistochemistry was performed and results were shown in Fig. 3A. FGFR3 was less expressed in the nucleus of pre-hypertrophic and hypertrophic chondrocytes in growth plate of control rats. However, the expression region of FGFR3 was extended from proliferative zone to hypertrophic zone and the intensity of brown staining was markedly increased in the growth plate of fluoride-treated rats. Quantitative results showed that the percentage of positive cells was significantly increased in fluorosis group compared with control group (P?<?0.05) (Fig. 3B).
Fig. 3. Fluoride regulated the expression of related proteins in rats during endochondral ossification. (A) Immunohistochemical was used to identify the expression of FGFR3, STAT1, Ihh and PTHrP in tibia growth plates of control rats (left panels) and fluorosis rats (right panels). Arrowheads indicated positive-staining sites of FGFR3, STAT1, Ihh and PTHrP in the growth plate. The percentage of positive cells of FGFR3 (B), STAT1 (C), Ihh (D) and PTHrP (E) were calculated. Data represent mean ± SD, *P < 0.05, n=3. All panels, magnification 40×. Scale bars: 50 ?m.
Fig. 4. Fluoride regulated the expression of related molecules in ATDC5 cells. (A) Western blot analysis of related proteins in ATDC5 cells which were treated with fluoride for 7 days. Quantitative analysis was shown that FGFR3, STAT1, GPC6 and EXT1 proteins were significantly increased in fluoride-treated cells compared with control cells (B–E). The results of real-time PCR were shown that the contents of FGFR3 (F) and PTHrP (G) mRNAs were significantly increased in fluoride-treated cells compared with control cells. Data represent mean ± SD, *P < 0.05, **P < 0.01, n=3.
In order to further verify the result, western blot and real-time PCR were used to detect the expression of FGFR3 in ATDC5 cells which were treated with fluoride for 7 days (Fig. 4 A and 4F, quantified in 4B). The results showed that the expression of FGFR3 protein and mRNA was significantly increased in fluoride-treated cells compared with control cells (P?<?0.05). These findings indicated that fluoride upregulated the expression of FGFR3 and might promote the expression of downstream signaling molecules.
To analyze whether STAT1, a downstream signal molecule of FGFR3, was activated by fluoride in growth plate, the expression level of STAT1 was observed by immunohistochemistry. As shown in Fig. 3A, STAT1 was expressed in nucleus and cytoplasm of pre-hypertrophic and hypertrophic chondrocytes in the growth plate of control rats. However, the intensity of staining was significantly enhanced in fluoride-treated rats compared with control rats. Quantitative results indicated that the percentage of positive cells in fluoride-treated growth plate was significantly increased compared with control rats (P?<?0.05) (Fig. 3C).
We also detected the expression of STAT1 protein in ATDC5 cells by western blot and found that the expression of STAT1 was significantly increased in fluoride-treated cells compared with control cells (P?<?0.01) (Fig. 4A, quantified in 4C). These results suggested that fluoride activated FGFR3 expression and promoted the expression of downstream signaling molecule STAT1.
3.4. Fluoride inhibited Ihh/PTHrP feedback loop during endochondral ossification
Next, in order to investigate the effect of fluoride on Ihh/PTHrP feedback loop, immunohistochemistry was used to observe the expression of Ihh and PTHrP (Fig. 3A). Ihh was mainly expressed in the cytoplasm of proliferative and pre-hypertrophic chondrocytes in control growth plate. However, Ihh was restricted to pre-hypertrophic chondrocytes in the growth plate of fluoride-treated rats and quantitative results indicated that there was significantly declined in the percentage of brown-stained cells in fluorosis growth plate, as compared with control rats (P?<?0.05) (Fig. 3D).
In contrast, PTHrP which was restricted to the cytoplasm of cells was mainly expressed in pre-hypertrophic and hypertrophic chondrocytes in control rats. The intensity of brown staining was significantly increased in fluoride-treated rats compared with control rats. Quantitative results showed that the percentage of positive cells was significantly increased in fluoride-treated rats compared with control rats (P?<?0.05) (Fig. 3E).
Additionally, the expression of Ihh and PTHrP mRNAs in ATDC5 chondrocytes was analyzed by real-time PCR. The findings showed that PTHrP mRNA expression was significantly increased in fluoride-treated cells compared with control cells (P?<?0.05), which was consistent with the result of immunohistochemistry (Fig. 4G). But the content of Ihh mRNA was too low to be detected both in fluoride-treated cells and control cells. Taken together, fluoride induced the expression of PTHrP, thereby inhibited the Ihh/PTHrP feedback loop.
4. Discussion and conclusions
Fluorosis have been studied for a long time and excessive ingestion of fluoride impairs tooth, skeletal muscle, kidneys, liver, nervous system and immune system, etc (Perumal et al., 2013; Yadav et al., 2019). Many studies have shown that fluoride regulates bone formation by affecting osteoblast and osteoclast activity (Jiang et al., 2019; Matsuda et al., 2014). However, there are few studies about the effect of fluoride on growth plate. In our studies, we treated SD rats and ATDC5 cells with excessive fluoride and carried out subsequent experiments. We found that excessive fluoride impaired normal morphology of growth plate, increased the expression of HSPG, activated FGFR3 pathways and inhibited Ihh/PTHrP feedback loop during endochondral ossification.
Fluoride mainly deposits on bones in the body and is essential for bone development. However, excessive fluoride has an impairment effect on bone morphology and delays the development of bone (Krishnamachari, 1986). The mechanism of bone development inhibition has been extensively studied and dysfunction of osteoblasts and osteoclasts is the main reason, but chondrocyte dysplasia may also play an important role in this inhibiting effect (Chavassieux, 1990; Sun and Beier, 2014). Endochondral ossification is the development process participated by chondrocytes and may be affected by fluoride (Chao et al., 2018). Previous studies have shown that excessive fluoride impairs chondrocyte proliferation and differentiation, enhances extracellular matrix synthesis, activates cartilage-related enzymes and delays endochondral ossification (Li et al., 1991; Liu et al., 1992; Xu and Guo, 2001). We found that the growth plate was thickened and the arrangement was disordered in fluoride-treated rats compared with control rats. We speculated that fluoride impaired growth plate and changed normal development of chondrocytes.
Extracellular matrix is involved in chondrocyte development and fluoride impairs the components of extracellular matrix. Prince et al. have found that the contents of C6S and DS are increased in fluorosis bone compared with bone from control rats (Prince and Navia, 1983). However, such findings are inconsistent with results reported by Zhou, who has found that the urinary GAG content in most fluorosis patients is lower than the control group (Zhou et al., 1992). In order to explore whether fluoride changes the cartilage extracellular matrix, we examined various GAGs in growth plate of rats by immunohistochemistry and the expression of EXT1 and GPC6 proteins was detected in ATDC5 cells by western blot. We found that the content of HS was increased in growth plate of fluorosis rats and the expression of EXT1 and GPC6 proteins was upregulated in ATDC5 cells after fluoride treatment compared with control cells. HSPG, one of ECM components, is combined by core protein and one or more HS chains. EXT1 is a kind of HS synthetic enzymes and is responsible for the synthesis of HS chains. Previous studies have found that EXT1Gt/Gt mice produce little amounts of EXT1 and result in synthesis of short HS chains (Koziel et al., 2004). Similarly, Osterholm et al. have found that the length of HS chains is shorted in EXT1Gt/Gt mutant fibroblasts and length is restored to that of wild type cells after transfecting EXT1 into Ext1Gt/Gt fibroblasts (Osterholm et al., 2009; Yamada et al., 2004). As a kind of HSPG core proteins, GPC6 mainly expresses in skeletal tissues and is involved in regulation of Hedgehog diffusion (Han et al., 2004). Based on these results, we suggested that fluoride might upregulate the expression of EXT1 and GPC6 to promote HSPG expression and further impair bone development.
HSPGs distribute on chondrocytes surface and in extracellular matrix and participate in the binding and transmission of signal molecules such as FGFR3 and Ihh/PTHrP (Dwivedi et al., 2013). HSPGs combine with FGFs and FGFRs to form a ternary complex and stabilize the binding of FGFs and FGFRs (Schlessinger et al., 2000). FGFR3, a major FGFR during endochondral ossification, is mainly expressed in pre-hypertrophic chondrocytes and inhibits chondrocyte proliferation and differentiation (Ornitz and Marie, 2002). STAT1 is a molecule which lies downstream of FGF signaling and inhibits chondrocyte proliferation and survival. Sahni and co-workers have observed the FGF-treated metatarsals in wild-type and STAT1?/? mice and have found that the chondrocytes proliferation and development in wild-type mice are impaired, however STAT1?/? mice have no similar phenotype (Sahni et al., 1999). FGF signaling activates STAT1 and plays a role in inhibiting chondrocyte proliferation and differentiation. Our results showed that excess of fluoride induced upregulation of FGFR3 in rat growth plates, activated downstream STAT1 expression and might inhibit chondrocyte proliferation.
The expression of HSPG is also vital for normal Hedgehog diffusion. HSPG modification generates binding sites for signal molecules such as Ihh (Bernfield et al., 1999). Ihh, as one of the hedgehog proteins, is expressed in pre-hypertrophic chondrocytes and transfers to periarticular region to active the expression of PTHrP. PTHrP conversely signals to its receptor (PTHrP-R) which expressed in the pre-hypertrophic chondrocytes and inhibits hypertrophic differentiation during endochondral ossification (Ohba, 2016). In our studies, we revealed that excessive fluoride lead to increase expression of PTHrP in growth plates. The inhibitory effect of PTHrP on Ihh expression was enhanced, so that Ihh expression was declined. PTHrP inhibited hypertrophic chondrocyte differentiation, accumulated pre-hypertrophic chondrocyte, eventually might increase the thickness of growth plate (Amling et al., 1997). Furthermore, FGFs signal lies upstream of Ihh/PTHrP feedback loop and negatively regulates the expression of Ihh (Minina et al., 2002). Thus, increased expression of FGFR3 inhibited Ihh/PTHrP feedback loop and might delay hypertrophic chondrocyte differentiation (Fig. 5).
Fig. 5. Fluoride regulated the expression of HSPG and related signaling pathways FGFR3 and Ihh/PTHrP feedback loop. Excessive fluoride increased the expression of HSPG, activated FGFR3 signaling pathway, thereby inhibiting hypertrophic chondrocyte differentiation. STAT1, a downstream molecule of FGFR3 signaling, was also activated, so that inhibited chondrocyte proliferation. Increased HSPG inhibited Ihh/PTHrP feedback loop and delayed the onset of hypertrophic differentiation. For details, see text. Orange line indicated HSPG expression. RZ, reserve zone; PZ, proliferative zone; HZ, hypertrophic zone.
In summary, our results showed that fluorosis resulted in increasing the expression of HSPG, activated FGFR3 pathway and inhibited Ihh/PTHrP feedback loop during endochondral ossification. These changes may inhibit chondrocyte proliferation and differentiation, result in retardation of growth plate development and maturation, thereby delaying long bone development. Our results open a new field about the effect of fluoride on the expression of HSPG and related signaling pathways FGFR3 and Ihh/PTHrP in growth plate during endochondral ossification. Additional work is necessary to clarify the exact mechanism about impairment of fluoride on growth plate.
Declaration of Competing Interest
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
Acknowledgment
This work was supported by a grant from the National Natural Science Foundation of China (NSFC) (NO. 81573100).
References
- Amling et al., 1997
-
M. Amling, L. Neff, S. Tanaka, D. Inoue, K. Kuida, E. Weir, W.M. Philbrick, A.E. Broadus, R. BaronBcl-2 lies downstream of parathyroid hormone-related peptide in a signaling pathway that regulates chondrocyte maturation during skeletal developmentJ. Cell Biol., 136 (1997), pp. 205-213
- Bernfield et al., 1999
-
M. Bernfield, M. Gotte, P.W. Park, O. Reizes, M.L. Fitzgerald, J. Lincecum, M. ZakoFunctions of cell surface heparan sulfate proteoglycansAnnu. Rev. Biochem., 68 (1999), pp. 729-777
- Chao et al., 2018
-
W. Chao, Y. Zhang, L. Chai, H. WangTranscriptomics provides mechanistic indicators of fluoride toxicology on endochondral ossification in the hind limb of Bufo gargarizansAquat. Toxicol., 201 (2018), pp. 138-150
- Yamada et al., 2004
-
S. Yamada, M. Busse, M. Ueno, O.G. Kelly, W.C. Skarnes, K. Sugahara, M. Kusche-GullbergEmbryonic fibroblasts with a gene trap mutation in Ext1 produce short heparan sulfate chainsJ. Biol. Chem., 279 (2004), pp. 32134-32141
- Yesildag et al., 2004
-
A. Yesildag, N. Hybeli, O. Candir, O. Oyar, B. Baykal, E.F. Mumcu, U.K. GulsoyEffects of fluoride on growth plate cartilage in rats: radiological and histopathological findingsFluoride, 37 (2004), pp. 221-230
- Zhai et al., 2000
-
C. Zhai, B.L. Chen, G.J. Dai, Z.Y. Zhang, X.X. Zhang, H.X. Gao, H.P. Lu, H.M. Li, F.J. Meng, J.Y. WeiEffects of the low fluoride in improvec drinking water on cone-age development of junior pupilsChin. J. Endemiol., 19 (2000), pp. 101-103
- Zhou et al., 1992
-
Q.L. Zhou, S.F. Chang, X.Q. Bai, C.W. Yang, Z. Chen, F.S. YangMetabolism of glycosaminoglycans in patients with drinking water fluorosisChin. J. Control Endemic Dis., 7 (1992), pp. 88-89
